BMR Genomics

Welcome to our NGS website

NGS

Universal ITS primers

For Fungi Kingdom identification we use the following primers from White et al. (1990):

ITS3f -GCATCGATGAAGAACGCAGC

ITS4r -TCCTCCGCTTATTGATATGC

This primers amplify the ITS2 region, about 300 bp long.

 

Note:
we also privide the primers for ITS1 region from White et al. (1990) but it is not our standard service:

ITS1f – TCCGTAGGTGAACCTGCGG

ITS2r – GCTGCGTTCTTCATCGATGC